Review



pgl3 u6 sgrna egfp addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc pgl3 u6 sgrna egfp addgene
    Pgl3 U6 Sgrna Egfp Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 506 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pCMV(CAT)T7-SB100+(Plasmid+%2334879)/pm39413784-842-66-67
    Average 96 stars, based on 506 article reviews
    pgl3 u6 sgrna egfp addgene - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Characterization and perturbation of CTCF-mediated chromatin interactions for enhancing myogenic transdifferentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BsaI NEB Cat#R3733S Lipofectamine 2000 Transfection reagent Invitrogen Cat#11668019 RNase inhibitor Clontech Cat#2313A dNTP mix Clontech Cat#4019 KAPA Pure Beads KAPA Cat#KK8001 Critical commercial assays PrimeScriptTM RT reagent Kit TAKARA Cat#RR047A NEBNext UltraTM RNA Library Prep Kit for Illumina NEB Cat#E7530L NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat#E7645 and E7335 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501-01 One-step DNA Lib Prep Kit for Illumina V2 Abclonal Cat#RK20238 High Sensitivity DNA Kit Agilent Cat#5067-4626 QubitTM dsDNA HS Assay Kit Invitrogen Cat#Q32851 Deposited data RNA-Seq This paper PRJNA726411 ChIP-Seq This paper PRJNA726411 BL-HiChIP This paper PRJNA726411 4C-Seq This paper PRJNA726411 scRNA-Seq This paper PRJNA726411 Experimental models: Cell lines C3H/10T1/2 Stem Cell Bank, Chinese Academy of Sciences RRID: CVCL_0190 C2C12 Stem Cell Bank, Chinese Academy of Sciences RRID: CVCL_0188 HEK293T Stem Cell Bank, Chinese Academy of Sciences RRID: CVCL_0063 Pig fibroblasts This paper N/A Chicken fibroblasts This paper N/A Oligonucleotides See Table S4 for all primers Mouse CTCF shRNA#1 GGGAGACAAAGAAGAGCAAAC This paper N/A Mouse CTCF shRNA#2 TGGACGATACCCAGATCATAA This paper N/A Mouse CTCF shRNA#3 GGTGCAATTGAGAACATTATA This paper N/A Mouse CTCF shRNA#4 GGAGCCTGCTGTAGAAATTGA This paper N/A Chicken CTCF siRNA GCAGGAGGGTTTATTATCT This paper N/A Pig CTCF siRNA GGGCTTATGAGAATGAAGT This paper N/A Bridge linker-F: 5’-/5P/CGCGATATC/iBIOdT/TATCTGACT30 Invitrogen Li et al. (2017b) Bridge linker-R: 5’-/5P/GTCAGATAAGATATCGCGT-30 Invitrogen Li et al. (2017b) (Continued on next page) Cell Reports 40, 111206, August 16, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pCW-Cas9 Addgene Cat#50661 pCW-MyoD This paper N/A psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pUC57-U6 Addgene Cat#115520 pGL3-U6 Addgene Cat51133 pGL3-Chrng This paper N/A CMV-EGFP-hspCas9 Zhao et al. (2017) N/A Software and algorithms Agilent Technologies 2100 bioanalyzer vB.02.10.SI764 Agilent https://www.agilent.com.cn Integrative Genomics Viewer v2.8.13 NIH freeware https://igv.org Juicebox v1.11.08 Durand et al. (2016) https://igv.org/doc/juiceboxjs.html ImageJ NIH freeware https://imagej.nih.gov/ij/ Adobe Illustrator Adobe https://www.adobe.com/products/ illustrator.html Metascape Zhou et al. (2019) http://metascape.org/gp/index.html#/ main/step1 GraphPad Prism v8.4.0 GraphPad https://www.graphpad.com/ scientific-software/prism/ Tool for sgRNA design The ZHANG lab https://zlab.bio/guide-design-resources SnapGene v4.2.1 Insight Science https://www.snapgene.com/? referrer=SnapGene trim_galore Bolger et al. (2014) https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ Bowtie2 Langmead and Salzberg (2012) http://bowtie-bio.sourceforge.net/bowtie2/ manual.shtml HTSeq Anders et al. (2015) https://htseq.readthedocs.io/en/master/ DESeq2 Love et al. (2014) https://bioconductor.org/packages/ release/bioc/html/DESeq2.html BWA Li and Durbin (2009) http://bio-bwa.sourceforge.net SAMtools Li et al. (2009) http://samtools.sourceforge.net MACS2 Feng et al. (2012) http://liulab.dfci.harvard.edu/MACS/ HOMER Heinz et al. (2010) http://homer.ucsd.edu/homer/ MEME Bailey et al. (2009) https://meme-suite.org/meme/ BEDtools Quinlan and Hall (2010) https://bedtools.readthedocs.io/en/latest/ ChromHMM Ernst and Kellis (2012) http://compbio.mit.edu/ChromHMM/ deepTools Ramı́rez et al. (2016) https://deeptools.readthedocs.io/en/latest/ index.html ChIA-PET2 Li et al. (2017a) https://github.com/GuipengLi/ChIA-PET2 HiC-Pro Servant et al. (2015) https://github.com/nservant/HiC-Pro FitHiChIP Bhattacharyya et al. (2019) https://github.com/ay-lab/FitHiChIP HiCRep Yang et al. (2017) https://github.com/qunhualilab/hicrep pipe4C Krijger et al. (2020) https://github.com/deLaatLab/pipe4C Mendeley v1.19.8 Mendeley https://www.mendeley.com CellRanger v7.0.0 103 Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ downloads/latest Seurat v4.1.1 Hao et al. (2021) satijalab.org/seurat/ (Continued on next page) e3 Cell Reports 40, 111206, August 16, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Monocle v2.22.0 Trapnell et al. (2014) http://cole-trapnell-lab.github.io/ monocle-release/docs/ Other PVDF membranes Millipore Cat#ISEQ00010 1.5 mL LoBind tube Eppendorf Cat#0030108051 Qubit 4.0 Invitrogen Cat#Q33238 Tube revolver Thermo Scientific Cat#88881002 Eppendorf ThermoMixer C Eppendorf Cat#5382000074

    Software:

    Article Title: Characterization and perturbation of CTCF-mediated chromatin interactions for enhancing myogenic transdifferentiation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER BsaI NEB Cat#R3733S Lipofectamine 2000 Transfection reagent Invitrogen Cat#11668019 RNase inhibitor Clontech Cat#2313A dNTP mix Clontech Cat#4019 KAPA Pure Beads KAPA Cat#KK8001 Critical commercial assays PrimeScriptTM RT reagent Kit TAKARA Cat#RR047A NEBNext UltraTM RNA Library Prep Kit for Illumina NEB Cat#E7530L NEBNext Ultra II DNA Library Prep Kit for Illumina NEB Cat#E7645 and E7335 TruePrep DNA Library Prep Kit V2 for Illumina Vazyme Cat#TD501-01 One-step DNA Lib Prep Kit for Illumina V2 Abclonal Cat#RK20238 High Sensitivity DNA Kit Agilent Cat#5067-4626 QubitTM dsDNA HS Assay Kit Invitrogen Cat#Q32851 Deposited data RNA-Seq This paper PRJNA726411 ChIP-Seq This paper PRJNA726411 BL-HiChIP This paper PRJNA726411 4C-Seq This paper PRJNA726411 scRNA-Seq This paper PRJNA726411 Experimental models: Cell lines C3H/10T1/2 Stem Cell Bank, Chinese Academy of Sciences RRID: CVCL_0190 C2C12 Stem Cell Bank, Chinese Academy of Sciences RRID: CVCL_0188 HEK293T Stem Cell Bank, Chinese Academy of Sciences RRID: CVCL_0063 Pig fibroblasts This paper N/A Chicken fibroblasts This paper N/A Oligonucleotides See Table S4 for all primers Mouse CTCF shRNA#1 GGGAGACAAAGAAGAGCAAAC This paper N/A Mouse CTCF shRNA#2 TGGACGATACCCAGATCATAA This paper N/A Mouse CTCF shRNA#3 GGTGCAATTGAGAACATTATA This paper N/A Mouse CTCF shRNA#4 GGAGCCTGCTGTAGAAATTGA This paper N/A Chicken CTCF siRNA GCAGGAGGGTTTATTATCT This paper N/A Pig CTCF siRNA GGGCTTATGAGAATGAAGT This paper N/A Bridge linker-F: 5’-/5P/CGCGATATC/iBIOdT/TATCTGACT30 Invitrogen Li et al. (2017b) Bridge linker-R: 5’-/5P/GTCAGATAAGATATCGCGT-30 Invitrogen Li et al. (2017b) (Continued on next page) Cell Reports 40, 111206, August 16, 2022 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pCW-Cas9 Addgene Cat#50661 pCW-MyoD This paper N/A psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pUC57-U6 Addgene Cat#115520 pGL3-U6 Addgene Cat51133 pGL3-Chrng This paper N/A CMV-EGFP-hspCas9 Zhao et al. (2017) N/A Software and algorithms Agilent Technologies 2100 bioanalyzer vB.02.10.SI764 Agilent https://www.agilent.com.cn Integrative Genomics Viewer v2.8.13 NIH freeware https://igv.org Juicebox v1.11.08 Durand et al. (2016) https://igv.org/doc/juiceboxjs.html ImageJ NIH freeware https://imagej.nih.gov/ij/ Adobe Illustrator Adobe https://www.adobe.com/products/ illustrator.html Metascape Zhou et al. (2019) http://metascape.org/gp/index.html#/ main/step1 GraphPad Prism v8.4.0 GraphPad https://www.graphpad.com/ scientific-software/prism/ Tool for sgRNA design The ZHANG lab https://zlab.bio/guide-design-resources SnapGene v4.2.1 Insight Science https://www.snapgene.com/? referrer=SnapGene trim_galore Bolger et al. (2014) https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ Bowtie2 Langmead and Salzberg (2012) http://bowtie-bio.sourceforge.net/bowtie2/ manual.shtml HTSeq Anders et al. (2015) https://htseq.readthedocs.io/en/master/ DESeq2 Love et al. (2014) https://bioconductor.org/packages/ release/bioc/html/DESeq2.html BWA Li and Durbin (2009) http://bio-bwa.sourceforge.net SAMtools Li et al. (2009) http://samtools.sourceforge.net MACS2 Feng et al. (2012) http://liulab.dfci.harvard.edu/MACS/ HOMER Heinz et al. (2010) http://homer.ucsd.edu/homer/ MEME Bailey et al. (2009) https://meme-suite.org/meme/ BEDtools Quinlan and Hall (2010) https://bedtools.readthedocs.io/en/latest/ ChromHMM Ernst and Kellis (2012) http://compbio.mit.edu/ChromHMM/ deepTools Ramı́rez et al. (2016) https://deeptools.readthedocs.io/en/latest/ index.html ChIA-PET2 Li et al. (2017a) https://github.com/GuipengLi/ChIA-PET2 HiC-Pro Servant et al. (2015) https://github.com/nservant/HiC-Pro FitHiChIP Bhattacharyya et al. (2019) https://github.com/ay-lab/FitHiChIP HiCRep Yang et al. (2017) https://github.com/qunhualilab/hicrep pipe4C Krijger et al. (2020) https://github.com/deLaatLab/pipe4C Mendeley v1.19.8 Mendeley https://www.mendeley.com CellRanger v7.0.0 103 Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ downloads/latest Seurat v4.1.1 Hao et al. (2021) satijalab.org/seurat/ (Continued on next page) e3 Cell Reports 40, 111206, August 16, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER Monocle v2.22.0 Trapnell et al. (2014) http://cole-trapnell-lab.github.io/ monocle-release/docs/ Other PVDF membranes Millipore Cat#ISEQ00010 1.5 mL LoBind tube Eppendorf Cat#0030108051 Qubit 4.0 Invitrogen Cat#Q33238 Tube revolver Thermo Scientific Cat#88881002 Eppendorf ThermoMixer C Eppendorf Cat#5382000074



    Similar Products

    pgl3 u6 sgrna egfp addgene  (Addgene inc)
    96
    Addgene inc pgl3 u6 sgrna egfp addgene
    Pgl3 U6 Sgrna Egfp Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pCMV(CAT)T7-SB100+(Plasmid+%2334879)/pm39413784-842-66-67
    Average 96 stars, based on 1 article reviews
    pgl3 u6 sgrna egfp addgene - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    addgene plasmid  (Addgene inc)
    94
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pGL3-U6-sgRNA-PGK-puromycin+(Plasmid+%2351133)/pm38033325-79-1-1
    Average 94 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    pgl3 u6 addgene  (Addgene inc)
    94
    Addgene inc pgl3 u6 addgene
    Pgl3 U6 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pGL3-U6-sgRNA-PGK-puromycin+(Plasmid+%2351133)/pm35977522-262-23-24
    Average 94 stars, based on 1 article reviews
    pgl3 u6 addgene - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    pst1374 nls flaglinker cas9 addgene  (Addgene inc)
    94
    Addgene inc pst1374 nls flaglinker cas9 addgene
    Pst1374 Nls Flaglinker Cas9 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pGL3-U6-sgRNA-PGK-puromycin+(Plasmid+%2351133)/pmc08972586__DataSheet1-1-129-130
    Average 94 stars, based on 1 article reviews
    pst1374 nls flaglinker cas9 addgene - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    pgl3 u6 sgrnapgk puromycin addgene  (Addgene inc)
    96
    Addgene inc pgl3 u6 sgrnapgk puromycin addgene
    Pgl3 U6 Sgrnapgk Puromycin Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/lentiCRISPR+v2+(Plasmid+%2352961)/pmc08972586__DataSheet1-1-125-126
    Average 96 stars, based on 1 article reviews
    pgl3 u6 sgrnapgk puromycin addgene - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    pgl3 u6 sgrna pgk puromycin addgene 51133 pte4398 addgene 74042 px330s 2 addgene 58778  (Addgene inc)
    94
    Addgene inc pgl3 u6 sgrna pgk puromycin addgene 51133 pte4398 addgene 74042 px330s 2 addgene 58778
    Pgl3 U6 Sgrna Pgk Puromycin Addgene 51133 Pte4398 Addgene 74042 Px330s 2 Addgene 58778, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pGL3-U6-sgRNA-PGK-puromycin+(Plasmid+%2351133)/pm35198885-201-0-1
    Average 94 stars, based on 1 article reviews
    pgl3 u6 sgrna pgk puromycin addgene 51133 pte4398 addgene 74042 px330s 2 addgene 58778 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    pgl3 u6 sgrna egfp addgene 107721 plasmid  (Addgene inc)
    94
    Addgene inc pgl3 u6 sgrna egfp addgene 107721 plasmid
    Pgl3 U6 Sgrna Egfp Addgene 107721 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pGL3-U6-sgRNA-EGFP+(Plasmid+%23107721)/pm30625312-171-231-232
    Average 94 stars, based on 1 article reviews
    pgl3 u6 sgrna egfp addgene 107721 plasmid - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    pgl3 u6 sgrna pgk puromycin addgene  (Addgene inc)
    94
    Addgene inc pgl3 u6 sgrna pgk puromycin addgene
    Pgl3 U6 Sgrna Pgk Puromycin Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pgl3+u6+addgene/pGL3-U6-sgRNA-PGK-puromycin+(Plasmid+%2351133)/pm30318148-453-123-124
    Average 94 stars, based on 1 article reviews
    pgl3 u6 sgrna pgk puromycin addgene - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results